View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14588_low_14 (Length: 225)
Name: NF14588_low_14
Description: NF14588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14588_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 26 - 209
Target Start/End: Original strand, 3543575 - 3543758
Alignment:
| Q |
26 |
aagtaatgttgttgattcagatgggtgatgaaaagttggagctggttttggtacttgaggaacaaagttcttgagaagtgtctagtcttgttttaatcta |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3543575 |
aagtaatgttgttgattcagatgggtgatgaaaagttggagctggttttggtacttgaggaacaaagttcttgagaagtgtctagtcttgttttaatcta |
3543674 |
T |
|
| Q |
126 |
aaatttgataacaatcaatgacattgaacatattttatgcacgcatgcagtcatatttttgtatctaaccacacttgtagaaac |
209 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| || ||||||||||||| |
|
|
| T |
3543675 |
aaatttgataacaatcaatgacattgagcatattttatgcacgcatgcaatcatatttttgtatctaccctcacttgtagaaac |
3543758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 26 - 99
Target Start/End: Original strand, 3530364 - 3530437
Alignment:
| Q |
26 |
aagtaatgttgttgattcagatgggtgatgaaaagttggagctggttttggtacttgaggaacaaagttcttga |
99 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| | |||||||||| ||||| ||||||||| |
|
|
| T |
3530364 |
aagtaatgttgttgattcagaggggtgatgaaaagttggagctgcctgtggtacttgaagaacagagttcttga |
3530437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University