View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14589_high_12 (Length: 279)
Name: NF14589_high_12
Description: NF14589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14589_high_12 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 26 - 279
Target Start/End: Complemental strand, 27844031 - 27843778
Alignment:
| Q |
26 |
actcgcttatttattattatattggaaatgctacttatcgggattgaatccacgcgaatctctcacgagaggaatataacatgtattgagtcactaactt |
125 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27844031 |
actcgcttatttcttattatatcggaaatgctacttatcgggattgaatccacgcgaatctctcacgagaggaatataacatgtattgagtcactaactt |
27843932 |
T |
 |
| Q |
126 |
gtattccaccaaagaaaatatctattgacttataagaaaattattgtgtgaaaattataatatatggaaaatataggtgtaacaactccccctttcttaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27843931 |
gtattccaccaaagaaaatatctattgacttataagaaaattattgtgtgaaaattataatatatggaaaatataggtgtaacaactccccctttcttaa |
27843832 |
T |
 |
| Q |
226 |
aaataattgtcatcaaattttacgataaatatatggaaaattacaatatttctt |
279 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27843831 |
aaataattgtcgtcaaattttacgataaatatatggaaaattacaatatttctt |
27843778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University