View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14589_low_13 (Length: 301)
Name: NF14589_low_13
Description: NF14589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14589_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 287
Target Start/End: Complemental strand, 40811491 - 40811229
Alignment:
| Q |
19 |
atcaccacaagcacatgcattgttgcatctgcatgtttgacaactccactaaattataaatcaacataaaaacattttactacatttttgctggattctt |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40811491 |
atcaccacaggcacatgcattgttgcatctgcatgtttgacaactccactaaattataaatcaacataaaaacattttac---atttttgctggattctt |
40811395 |
T |
 |
| Q |
119 |
tctgggtacaaagcaaaatagaatgcgtgatttaatttttt-ataaattttaagttacgtagtagtactattaattattgttgttgttgcttctggttac |
217 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40811394 |
tctgagaacaaagcaaaatagaatgcgtgatttaatttttttataaattttaagttacgtagtagtactatta----ttgttgttgttgcttctggttac |
40811299 |
T |
 |
| Q |
218 |
tactagttagtattgatgtttggtaccttaaaccgtaacattcacgtgtactatatatattgtttgtgat |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40811298 |
tactagttagtattgatgtttggtaccttaaaccgtaacattcacgtgtactatatatattgtttgtgat |
40811229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University