View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14589_low_18 (Length: 238)
Name: NF14589_low_18
Description: NF14589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14589_low_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 5 - 238
Target Start/End: Original strand, 39526604 - 39526837
Alignment:
| Q |
5 |
atttaccttctaaatatggttttgaaataacaacttcaaggtatggcaattttggtaaaccagtacgaattttcagtattacttaatctatttattagca |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39526604 |
atttaccttctaaatatggttttgaaataacaacttcaaggtatggcaattttggtaaaccagtacgaattttcagtattacttaatctatttattagca |
39526703 |
T |
 |
| Q |
105 |
aaacaatcataatcaaacacttttaacgaaattattatttaaccaattcagtttttaggcaataaaaggagagactctgtcctacctttataatattcaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
39526704 |
aaacaatcataatcaaacacttttaacgaaattattatttaaccaattcagtttttaggcaataaaaggagagacactgtcctacatttataatattcaa |
39526803 |
T |
 |
| Q |
205 |
acagaacataaaccaacaaatattttcctgccaa |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
39526804 |
acagaacataaaccaacaaatattttcttgccaa |
39526837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University