View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14589_low_22 (Length: 224)
Name: NF14589_low_22
Description: NF14589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14589_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 36 - 209
Target Start/End: Complemental strand, 29800936 - 29800761
Alignment:
| Q |
36 |
agactagtgaaaagtaaacggagaggaacaaagaatgcaaagaggtcgtgagac--agacaatcaagtagatttgatttatccattctactaatgaaaat |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29800936 |
agactagtgaaaagtaaacggagaggaacaaagaatgcaaagaggtcgtgagacaaagacaatcaagtagatttgatttatccactctactaatgaaaat |
29800837 |
T |
|
| Q |
134 |
tataaagnnnnnnnnnnnnnnnnnnatcatagacttaatccaccattaaacttgaactttggcatgattgatactt |
209 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29800836 |
tataaagttttttattttattttttatcatagacttaatccaccattaaacttgaactttggcatgatcgatactt |
29800761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University