View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14589_low_8 (Length: 391)
Name: NF14589_low_8
Description: NF14589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14589_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 1 - 382
Target Start/End: Original strand, 1390937 - 1391318
Alignment:
| Q |
1 |
tgctaaactgcacctatgcttctttttcattgaagctactgaactttacctaattgagatatctttacccttggcaacaaaatctgtaaatagatgaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1390937 |
tgctaaactgcacctatgcttctttttcattgaagctactgaactttacctaattgagatatctttacccttggcaacaaaatgagtaaatagatgaatt |
1391036 |
T |
|
| Q |
101 |
ggtccctatttgtgagcatttttgtcaaaatagtccctggaatatgctatttgacaaataaatccataaaatgtaacacatcagtcagaatggtctcact |
200 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
1391037 |
ggtccctaatcgtgagcatttttgtcaaaatagtccctgaaatatgctatttgacaaataaatccataaactgtaacacatcaatcagaatggtctcact |
1391136 |
T |
|
| Q |
201 |
gttagtttattcctcgagatactatgatgcggcgcgttcattgagcatgtagcattccacctggatgaccaaatgttcgtttagcgcatcagatcatagc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1391137 |
gttagtttattcctcgagatactatgatgtggcgcgttcattgagcatgtagcattccacctggatgaccacatgttcgtttagcgcatcagatcatagc |
1391236 |
T |
|
| Q |
301 |
cttccgcatcagagatcatttgccgatttgtacaatttagagactatttggaccgttgtttacaattttgaggaacatattc |
382 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1391237 |
cttccacatcagagatcatttgccgatttgtacaatttagagactatttggaccgttgtttacaattttgaagaacatattc |
1391318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University