View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1458_high_21 (Length: 264)
Name: NF1458_high_21
Description: NF1458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1458_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 22 - 249
Target Start/End: Original strand, 31594150 - 31594364
Alignment:
| Q |
22 |
gctattaattcttcatcgaccatattcaccaaagaagactttgcagcaattaagattcaagcttatttcaggggtcatctcgtatgtgattcataatttg |
121 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31594150 |
gctattaattcttcattgaccatattcaccaaagaagactttgcagcaattaagattcaagcttatttcaggggtcatctagtatgtgattcataatttg |
31594249 |
T |
 |
| Q |
122 |
tagcaactatatcaattttgctagcaagtgtatagttgcatatagtttttgactaacttttttgaattaaaagtacaaaatgtgtctcatgttaattgac |
221 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
31594250 |
tagcaactatatcaatattgctagcaagt----------atatagtttttgactaacttttttgaataaaaagtacaaaa--tgtctcatgttaattgac |
31594337 |
T |
 |
| Q |
222 |
ttgattttgctactattgaattgaattg |
249 |
Q |
| |
|
|||| ||||||||||||||||||||||| |
|
|
| T |
31594338 |
ttga-tttgctactattgaattgaattg |
31594364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University