View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1458_high_24 (Length: 258)
Name: NF1458_high_24
Description: NF1458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1458_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 28330374 - 28330130
Alignment:
| Q |
1 |
ccagaagaaccttcagaattatcagcactaggaggaattgattccgcattggcaacaggagattttgatgctttagaccctgtatttgagccattatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28330374 |
ccagaagaaccttcagaattatcagcactaggaggaattgattccgcattggcaacaggagattttgatgctttagaccctgtatttgagccattatcca |
28330275 |
T |
|
| Q |
101 |
aacctttggtaaaccctgtttcagatgctactatcccttggaattcctcgctaacaattattgcagccaaaacatccataaatgattctttatctgttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28330274 |
aacctttggtaaaccctgtttcagatgctactatcccttggaattcctcgctaacaattattgcagccaaaacatccataaatgattctttatctgttgg |
28330175 |
T |
|
| Q |
201 |
gtacgcagattctcttacgcccatcttatcagtgacatttgcttc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28330174 |
gtacgcagattctcttacgcccatcttatcagtgacatttgcttc |
28330130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 44781852 - 44781608
Alignment:
| Q |
1 |
ccagaagaaccttcagaattatcagcactaggaggaattgattccgcattggcaacaggagattttgatgctttagaccctgtatttgagccattatcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44781852 |
ccagaagaaccttcagaattatcagcactaggaggaattgattccgcattggcaacaggagattttgatgctttagaccctgtatttgagccattatcca |
44781753 |
T |
|
| Q |
101 |
aacctttggtaaaccctgtttcagatgctactatcccttggaattcctcgctaacaattattgcagccaaaacatccataaatgattctttatctgttgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44781752 |
aacctttggtaaaccctgtttcagatgctactatcccttggaattcctcgctaacaattattgcagccaaaacatccataaatgattctttatctgttgg |
44781653 |
T |
|
| Q |
201 |
gtacgcagattctcttacgcccatcttatcagtgacatttgcttc |
245 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44781652 |
gtacgcagattctcttacgcccgtcttatcagtgacatttgcttc |
44781608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University