View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1458_high_25 (Length: 250)
Name: NF1458_high_25
Description: NF1458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1458_high_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 47562832 - 47562593
Alignment:
| Q |
1 |
tacttttttacataaattttggaatggtgtttcttactatgcaatttgagattatgatggtctacatatatttccagatagatttaggatgttgacatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47562832 |
tacttttttacataaattttggaatggtgtttcttactatgcaatttgggattatgatggtctacatatatttccagatacatttaggatgttgacatac |
47562733 |
T |
 |
| Q |
101 |
acatgtgtatttttaagagagtccattcgttagaagatgcatgccaaacccattgttgagatggggtgaatcatagggaaaactaatgctattaattata |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47562732 |
gcatgtgtatttttaagagagtcaattcgttagaagatgcatgccaaacccaatgctaagatggggtgaatcatagggaaaactaatgctattaattata |
47562633 |
T |
 |
| Q |
201 |
atttannnnnnngttttgtttcaatgtgagtatagtataat |
241 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47562632 |
attta-ttttttgttttgtttcaatgtgagtatagtataat |
47562593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University