View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1458_high_32 (Length: 233)
Name: NF1458_high_32
Description: NF1458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1458_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 41985915 - 41985821
Alignment:
| Q |
1 |
ttgaatatgctatgtttgcaactatactcattatatgtgcaaatcttaacaaagtctatcttaatatcctctttcagtgaaaactcaagcataaa |
95 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41985915 |
ttgaatatgctatgtttgcaactatacacattatatgtgcaaatcttaacaaagtctatcttaatatcctctttcagtgaaaactcaagcataaa |
41985821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 170 - 216
Target Start/End: Complemental strand, 41985788 - 41985742
Alignment:
| Q |
170 |
acaatatgcaagggaaataatttgaagtgagttggctatacctttgg |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41985788 |
acaacatgcaagggaaataatttgaagtgagttggctatacctttgg |
41985742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University