View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1458_high_35 (Length: 223)
Name: NF1458_high_35
Description: NF1458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1458_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 7 - 210
Target Start/End: Complemental strand, 27125058 - 27124855
Alignment:
| Q |
7 |
attaataggttgaaccgtgaaccattgttcttggaattggacttgcaaaccctctacttcatcttgaagaaggagtgtgaggaatccatagtcagaatga |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27125058 |
attaataggttgaaccgtgaaccattgttcttggaattggacttgcaaaccctctacctcatcttgaagaaggagtgtgaggaatccatagtcagaatga |
27124959 |
T |
 |
| Q |
107 |
gggggcatgcctagggttaggtcaggttgaggacatggaggataaaaatttgccgccataagctggcttccatcttccaattctttgataatattgtcct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27124958 |
gggggcatgcctagggttaggtcaggttgaggacatggtggataaaaatttgccgccataagctggcttccatcttccaattctttgataagattgtcct |
27124859 |
T |
 |
| Q |
207 |
tttc |
210 |
Q |
| |
|
|||| |
|
|
| T |
27124858 |
tttc |
27124855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 10 - 201
Target Start/End: Original strand, 41604248 - 41604439
Alignment:
| Q |
10 |
aataggttgaaccgtgaaccattgttcttggaattggacttgcaaaccctctacttcatcttgaagaaggagtgtgaggaatccatagtcagaatgaggg |
109 |
Q |
| |
|
|||||||||||| |||| ||||| ||||| |||||| |||||||||||| ||||||||||| || || ||||||||||| ||||| ||||| |||||| |
|
|
| T |
41604248 |
aataggttgaacagtgagccatttgtcttgatattggatttgcaaaccctccacttcatcttggaggagaagtgtgaggaagccataatcagagtgaggg |
41604347 |
T |
 |
| Q |
110 |
ggcatgcctagggttaggtcaggttgaggacatggaggataaaaatttgccgccataagctggcttccatcttccaattctttgataatatt |
201 |
Q |
| |
|
|||| || || |||||||| |||| ||| ||||| || |||||||| | ||| | |||||| |||| ||||||||||| |||||||| |
|
|
| T |
41604348 |
tgcattccaagtgttaggtctggttcagggcatggtgggtaaaaattggttaccaacatctggctcccattgtccaattctttcataatatt |
41604439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University