View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1458_high_6 (Length: 466)
Name: NF1458_high_6
Description: NF1458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1458_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 232 - 446
Target Start/End: Original strand, 50883766 - 50883980
Alignment:
| Q |
232 |
gagctctctttgttcgtatattgatcctttctctttgattgttttatcttgagttgatcctttttcagttgatttatgtttgatttagttcaattcgatt |
331 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||| ||||||||||||| |
|
|
| T |
50883766 |
gagctctctttatttgtatattgatcctttctctttgattgttttgtcttgagttgatcctttctcggttgatttatgtttgatttggttcaattcgatt |
50883865 |
T |
|
| Q |
332 |
catctctttggttgcttatttttctctttgattgattctttatatatgttgattgctttgtttgtttgatcgatcatgtctctattgacttctttatgtt |
431 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
50883866 |
catctctttggttgcttatttttctctttgattgattctttatatatgttgattgctttgtttgtttgatcgatcatgtctctattggcttctttatgtt |
50883965 |
T |
|
| Q |
432 |
tgattgctcatctcc |
446 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
50883966 |
tgattgctcatctcc |
50883980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 17 - 170
Target Start/End: Original strand, 50883551 - 50883704
Alignment:
| Q |
17 |
aatatacacaaagagtgaggcaccatgataaacaatttgtgtgttagataatacgtaatgagattttagttgtaattgtgttaagagtagttgtgtttat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50883551 |
aatatacacaaagagtgaggcaccatgataaacaatttgtgtgttagataatacgtaatgagattttagttgtaattgtgttaagagtagttgtgtttat |
50883650 |
T |
|
| Q |
117 |
taatatttcactatttatcagtagagtaaatattttgtattctaaattttgctc |
170 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50883651 |
taatatttcactatttattagtagagtaaatattttgtattctaaattttgctc |
50883704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University