View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1458_low_16 (Length: 357)
Name: NF1458_low_16
Description: NF1458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1458_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 18 - 347
Target Start/End: Original strand, 54852628 - 54852957
Alignment:
| Q |
18 |
gtgttcagcgaaatgtgaaggctgttcatgtatttttaactcagtctcagaagttcgtttgttttttgggtgattaaggtgttatcttggtagtatctca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54852628 |
gtgttcagcgaaatgtgaaggctgttcatgtatttttaactcagtctcaaaggttcgtttgttttttgggtgattaaggtgttatattggtagtatctca |
54852727 |
T |
 |
| Q |
118 |
aaatccatgtttgattgttggcgatccattagtagatgctttctagcattttcttttgtcgatcgtggcctgttagtggcttggagcgatatctaagatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54852728 |
aaatccatgtttgattgttggcgatccattagtagatgcttcctagcattttcttttgtcgatcctggcctgttagtggcttggagcgatatctaagatg |
54852827 |
T |
 |
| Q |
218 |
cctaactccttggtcagctcagttgtaactttgctgtgctggaaaccggaatttgtgcatgtgaaatggctttcttgattttggagcattgtgttgtgat |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54852828 |
cctaactccttggtcagctcagttgtaactttgctgtgctggaaaccggaatttgtgcatgtgaaatggctttcttgattttggagcattgtgttgtgat |
54852927 |
T |
 |
| Q |
318 |
tttggagttggtagcaaggtgctctctgtg |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54852928 |
tttggagttggtagcaaggtgctctctgtg |
54852957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University