View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1458_low_21 (Length: 316)
Name: NF1458_low_21
Description: NF1458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1458_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 299
Target Start/End: Original strand, 3239086 - 3239382
Alignment:
| Q |
1 |
aataaaacaataggagtacctttgaagagaattaagatgttgaaggagctataaaaacattgaaatgaggaagatggttattccttcaaatccagaagcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3239086 |
aataaaacaataggagtacctttgaagagaattaagacgttgaaggagctataaaaacattgaaatgaggaagatggttattccttcaaatccagaagcc |
3239185 |
T |
 |
| Q |
101 |
attgattttggatccatttctcatcattatatgaaacttcttttgatatagggaatgttattgatcacacatgcaaaagcctttgtttaattttcttttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
3239186 |
attgattttggatccatttctcatcattat--gaaacttcttttgatatagggaatgttattgatcacacatgcaaaagcctttgttcaatttccttttt |
3239283 |
T |
 |
| Q |
201 |
tcttataatttcatatagggaagtatcaaaatggcataagaaattgagtttcaaatgcaaaatctaaaatgaatgaaagaatacaagagaagggtttgt |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3239284 |
tcttataatttcatatagggaagtatcaaaatggcataagaaattgagtttcaaatgcaaaatctaaaatgaatgaaagaatacaagagaagggtttgt |
3239382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University