View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1458_low_33 (Length: 237)
Name: NF1458_low_33
Description: NF1458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1458_low_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 7388102 - 7387882
Alignment:
| Q |
1 |
ttgttatatgatgcatttctattgtttctactttgtagtttaagcaatgttttaaaaaccgaaatgaaaatctaattggtgatattttaggggaatgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| | |
|
|
| T |
7388102 |
ttgttatatgatgcatttctattgtttctactttgtagtttaagcaatgttttaaaaaccgaaatgaaaatctaatcggtgatatttaaggggaatgacg |
7388003 |
T |
 |
| Q |
101 |
taattggttcaatcagttcaat-acagttaaattggatgataaataaatataaattaagaagtnnnnnnnttaaaaccggttgaagaaactatttcaacc |
199 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||| |||||| |
|
|
| T |
7388002 |
taattggttcaatcagttcaatcacggttaaattggatgattaataaatataaattaagaagtaaaaaaattaaaaccggttgaaaaaactagttcaact |
7387903 |
T |
 |
| Q |
200 |
ggttcaatgagactactatac |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7387902 |
ggttcaatgagactactatac |
7387882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University