View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1458_low_38 (Length: 226)
Name: NF1458_low_38
Description: NF1458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1458_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 30072858 - 30073076
Alignment:
| Q |
1 |
tttaggaagaaggattataatacacatacatgatttatacaaagatatagagtaggaataagtatatttcagattgcttttgatatttgtaattataagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30072858 |
tttaggaagaaggattataatacacatacatgatttatacaaaaatatagagtaggaataagtatatttcagattgcttttaatatttgtaattataagt |
30072957 |
T |
 |
| Q |
101 |
gattatgaatttgatctcagtattctgcatacttttgtaatcgggtcttttttatcagctgtagtgagatatgatatatctttgaatgatgccccttatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30072958 |
gattatgaatttgatctcagtattctgcagacttttgtaatcgggtcttttttatcagctgtagtgagatatgatatatctttgaatgatgcccctta-t |
30073056 |
T |
 |
| Q |
201 |
ctagaaaatgtgggacctat |
220 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30073057 |
atagaaaatgtgggacctat |
30073076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University