View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1458_low_41 (Length: 220)
Name: NF1458_low_41
Description: NF1458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1458_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 19 - 207
Target Start/End: Original strand, 37344812 - 37345000
Alignment:
| Q |
19 |
aagacatgtccaaaaaacaaaattgaatgcactaattatacaacttctacatgtaaaggagtggcagtaggattctccaagatttgtcttgtttgcctag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37344812 |
aagacatgtccaaaaaacaaaattgaatgcactaattatacaacttctacatgtaaaggagtggcagtaggattctccaagatttgtcttgtttgcctag |
37344911 |
T |
 |
| Q |
119 |
gagacaccgacataagtgacataacaataggtttaagcttctcagtagttttgataataatcaaaaacagaactcgatatagaataatc |
207 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
37344912 |
gagacaccgacataaatgacataacaataggtttaagcttctcagtagttttgataataatcaaaaacacaactcgatatagaacaatc |
37345000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University