View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14590_high_7 (Length: 230)
Name: NF14590_high_7
Description: NF14590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14590_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 20 - 111
Target Start/End: Original strand, 7779123 - 7779214
Alignment:
| Q |
20 |
gtgctaatcacgagttttatgttctaaacaagatgaacataaaagtgggagctatgtgttaacacaattaaaagtgaggatagaaggacgtg |
111 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7779123 |
gtgctaagcacgagttttatgttctaaacaagatgaacatagaagcgggagctatttgttaacacaattaaaagtgaggatagaaggacgtg |
7779214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University