View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14590_low_7 (Length: 230)

Name: NF14590_low_7
Description: NF14590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14590_low_7
NF14590_low_7
[»] chr3 (1 HSPs)
chr3 (20-111)||(7779123-7779214)


Alignment Details
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 20 - 111
Target Start/End: Original strand, 7779123 - 7779214
Alignment:
20 gtgctaatcacgagttttatgttctaaacaagatgaacataaaagtgggagctatgtgttaacacaattaaaagtgaggatagaaggacgtg 111  Q
    ||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||    
7779123 gtgctaagcacgagttttatgttctaaacaagatgaacatagaagcgggagctatttgttaacacaattaaaagtgaggatagaaggacgtg 7779214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University