View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14591_low_6 (Length: 258)
Name: NF14591_low_6
Description: NF14591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14591_low_6 |
 | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0085 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 14 - 233
Target Start/End: Complemental strand, 42528 - 42310
Alignment:
| Q |
14 |
caaaggaaagaccgggcattaagacttatcttagaaaaaatctaaatattcggaaaaatccaagttccacttagaggatataaaaggctttatcatttat |
113 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
42528 |
caaaggaaagacagggcattaagacttctcttagaaaaaatttaaatattcggaaaaatccaagtttcacttagaggatataaaaggttttatcatttat |
42429 |
T |
|
| Q |
114 |
ctataagttgattttggaaggataagttagacacacaaaaagttagagtctcttcattaaattttaagattagaacagacctctttttgtagtttttaaa |
213 |
Q |
| |
|
|||||||||| |||||| ||||| ||||| || | | ||| ||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42428 |
ctataagttggttttgggaggatgagttacac-taaagaaaattaaagtctctcaattaaattttaagattagaacagacctttttttgtagtttttaaa |
42330 |
T |
|
| Q |
214 |
tgtcaatatcaagttagttt |
233 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42329 |
tgtcaatatcaagttagttt |
42310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University