View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14591_low_7 (Length: 232)
Name: NF14591_low_7
Description: NF14591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14591_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 46603359 - 46603141
Alignment:
| Q |
1 |
gccaaataactcaagaaagtcggtggtgtttgagtttgatgccagctgtttgtataaaaactgcctaactgcttctatattatttccacaatactccaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46603359 |
gccaaataactcaagaaagtcggtggtgtttgagtttgatgccagctgtttgtataaaaactgcctaactgcttctatattatttccacaatactccaaa |
46603260 |
T |
|
| Q |
101 |
attcattaatttatgccacg-gggcggcttaccgtgctttaacttatttgttctctatgcttttgtgtcaaattgtccaactaacttacaagcccttttc |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46603259 |
attcattaatttatgccacgagggcggcttaccgtgctttaacttatttgttctctatgcttttgtgtcaaattgtccaactaacttacaagcccttttc |
46603160 |
T |
|
| Q |
200 |
ccttttttataatattctt |
218 |
Q |
| |
|
|||||||| ||||| |||| |
|
|
| T |
46603159 |
ccttttttctaataatctt |
46603141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University