View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14592_high_11 (Length: 272)

Name: NF14592_high_11
Description: NF14592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14592_high_11
NF14592_high_11
[»] chr4 (1 HSPs)
chr4 (18-111)||(3245676-3245769)


Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 111
Target Start/End: Complemental strand, 3245769 - 3245676
Alignment:
18 attgttggatttaagaattgaatgatagagannnnnnnncaaagttttgtattgattcattatttgaaattttgaaggcagtggtcttcctatc 111  Q
    ||||||||||||||||||||||||||| |||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3245769 attgttggatttaagaattgaatgataaagattttttttcaaagttttgtattgattcattatttgaaattttgaaggcagtggtcttcctatc 3245676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University