View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14592_high_5 (Length: 452)
Name: NF14592_high_5
Description: NF14592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14592_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 117; Significance: 2e-59; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 15 - 147
Target Start/End: Complemental strand, 31046422 - 31046290
Alignment:
| Q |
15 |
ttcttaagaatatgagtaaacaaaccggtaggaagagacaaatcaaattcattcacgacaatatgtcaaattggagtgtgtgaagagaagaagatgaaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31046422 |
ttcttaagaatatgagtaaacaaaccggtaggaagagacaaatcaaattcattcacgacaatatgttaaattggagtgtgtgaagagaagaagatgaaga |
31046323 |
T |
|
| Q |
115 |
tggaagtttagtgatttagtgctttggtatttg |
147 |
Q |
| |
|
||| ||| ||||||||||||| ||||||||||| |
|
|
| T |
31046322 |
tggcagtgtagtgatttagtggtttggtatttg |
31046290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 381 - 431
Target Start/End: Complemental strand, 31046121 - 31046071
Alignment:
| Q |
381 |
aaatgcaatcacctgtaatccataacatcaaccacaataatgacatgatat |
431 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31046121 |
aaatgcaatcacttgtaatccataacatcaaatacaataatgacatgatat |
31046071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 302 - 351
Target Start/End: Complemental strand, 31052091 - 31052043
Alignment:
| Q |
302 |
aaaataagactaaattgattgacgaaaacatatcttaagaggccaaaacg |
351 |
Q |
| |
|
||||||||||||||||||| |||||||| |||| ||||||| |||||||| |
|
|
| T |
31052091 |
aaaataagactaaattgatcgacgaaaatatat-ttaagagaccaaaacg |
31052043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 233 - 270
Target Start/End: Complemental strand, 31103398 - 31103361
Alignment:
| Q |
233 |
ttagtggtttattattagatttaatagtcttgcatgat |
270 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
31103398 |
ttagtggtttattattagatttaatggtcttgtatgat |
31103361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 236 - 270
Target Start/End: Complemental strand, 9559317 - 9559283
Alignment:
| Q |
236 |
gtggtttattattagatttaatagtcttgcatgat |
270 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |
|
|
| T |
9559317 |
gtggtttattattagattcaatagtcttgcatgat |
9559283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University