View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14592_low_19 (Length: 225)
Name: NF14592_low_19
Description: NF14592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14592_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 221
Target Start/End: Original strand, 21983315 - 21983529
Alignment:
| Q |
7 |
gttgggtccaaaaacttggagcctcttctctccttcctcggatgagagaccctctttggtacattttagctgctgaaatacttcatcaattggaatgttt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21983315 |
gttgggtccaaaaacttggagcctcttctctccttcctcggatgagagaccctctttggtacattttagctgctgaaagacttcatcaattggaatgttt |
21983414 |
T |
 |
| Q |
107 |
tcctacacacatataatcaatgtcattataataaaaatgtaaatggtatattattcattatttctattagggttttaaatattgcgatatttgatattgc |
206 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21983415 |
tcctacacacatatgatcaatgtcattattataaaaatgtaaatggtatattattcattattcctattagggttttaaatattgcgatatttgatattgc |
21983514 |
T |
 |
| Q |
207 |
agtcaaaaactgtaa |
221 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
21983515 |
agacaaaaactgtaa |
21983529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 115
Target Start/End: Original strand, 48439931 - 48439991
Alignment:
| Q |
55 |
accctctttggtacattttagctgctgaaatacttcatcaattggaatgttttcctacaca |
115 |
Q |
| |
|
||||||| | ||||||||||| |||| || ||||| ||||||||||||||||||| |||| |
|
|
| T |
48439931 |
accctctctagtacattttagttgcttgaagacttcctcaattggaatgttttcctgcaca |
48439991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University