View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14592_low_9 (Length: 336)
Name: NF14592_low_9
Description: NF14592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14592_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 5 - 165
Target Start/End: Original strand, 40859148 - 40859315
Alignment:
| Q |
5 |
cttattcctaatatccttcaatgtgtatgaatgtcatcaacgctgtcgtggttcaacattgcatgcaaaatttaattttattcaaaatttgacaaaatga |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40859148 |
cttattcctaatatccttcaatgtgtatgaatgtcatcaacgctgtcgtggttcaacattgcatgcaaaatttaattttgttcaaaatttgacaaaatga |
40859247 |
T |
|
| Q |
105 |
ctaacaaacaaaggggaaattgg-------taaatattattatgttttgattggcaatgaaaaataag |
165 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40859248 |
ctaacaaacaaaggggaaattggtaaatattaaatattattatgttttgattggcaatgaaaaataag |
40859315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 254 - 336
Target Start/End: Original strand, 40859407 - 40859489
Alignment:
| Q |
254 |
gaagttggaattcgaactgtcaactttcttatcactccatttactctcacttctacgacaaattcatccttatatccccttgc |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40859407 |
gaagttggaattcgaactgtcaactttcttatcactccatttactctcacttctatgacaaattcatccttatatccccttgc |
40859489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University