View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14593_high_13 (Length: 259)
Name: NF14593_high_13
Description: NF14593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14593_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 15 - 94
Target Start/End: Original strand, 12265252 - 12265331
Alignment:
| Q |
15 |
agttttgacatctaattaaaactatatttagtgtatatgcatttacatcattgatatttgtaaagtgatttataatttac |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
12265252 |
agttttgacatctaattaaaactatatttagtgtatatgcatttacatcatttatatttgtaaagtgatttatcatttac |
12265331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University