View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14593_high_9 (Length: 309)
Name: NF14593_high_9
Description: NF14593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14593_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 24 - 292
Target Start/End: Complemental strand, 43268019 - 43267751
Alignment:
| Q |
24 |
ggtcttgaccagacatcttctttgaattttccaccaccatcagcttgttcaattgcattacacactttatcttgtgcttctcttatcatcttctcgaatc |
123 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43268019 |
ggtcttgaccaaacatcttctttgaattttccaccaccatcagcttgttcaattgcattacacactttatcttgtgcttctcttatcatcttctcgaatc |
43267920 |
T |
 |
| Q |
124 |
gagctcgaacggaagatgcggtggctccatcgttgtcgacgccgcggagaaatgtatcggggcgttctgattctggtgtttctttttctattgaaacggt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43267919 |
gagctcgaacggaagatgcggtggctccgtcgttgtcgacgccgcgaagaaatgtatcggggcgttctgattctggtgtttctttttcaattgaaacggt |
43267820 |
T |
 |
| Q |
224 |
tgcttttgttataagtcgttgaaagtggtgagaagatgtggttttacgcgtttgtgtagtgagtgattt |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43267819 |
tgcttttgttataagtcgttgaaagtggtgagaagatgtggttttacgggtttgtgtagtgagtgattt |
43267751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University