View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14593_low_15 (Length: 296)
Name: NF14593_low_15
Description: NF14593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14593_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 24 - 279
Target Start/End: Complemental strand, 23546262 - 23546007
Alignment:
| Q |
24 |
atcaaatctttgcaagattgctacgaatttgcttaacgattgtttccgaggcgagctcgtagcnnnnnnncgctgagttcttgaccagtggattcatcag |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23546262 |
atcaaatctttgcaagattgctacgaatttgcttaacgattgtttccgaggcgagatcgtagcaaaaaaacgctgagttcttgaccagtggattcatcag |
23546163 |
T |
|
| Q |
124 |
ggtttataagatgaaacgattcagaatcagcatttcccacaacatgttcgaaatttgcacgcatatacataagctcttcagaatctgacccaaaacctga |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23546162 |
ggtttataagatgaaacgattcagaatcagcatttcccacaacatgttcgaaatttgcacgcatatacataagctcttcagaatctgacccaaaacctga |
23546063 |
T |
|
| Q |
224 |
aggtataacacctgcaccgacggtgacacactgcatggtttgtagtatgttgcgga |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23546062 |
aggtataacacctgcaccgacggtgacacactgcatggtttgtagtatgttgcgga |
23546007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University