View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14593_low_19 (Length: 259)

Name: NF14593_low_19
Description: NF14593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14593_low_19
NF14593_low_19
[»] chr2 (1 HSPs)
chr2 (15-94)||(12265252-12265331)


Alignment Details
Target: chr2 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 15 - 94
Target Start/End: Original strand, 12265252 - 12265331
Alignment:
15 agttttgacatctaattaaaactatatttagtgtatatgcatttacatcattgatatttgtaaagtgatttataatttac 94  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||    
12265252 agttttgacatctaattaaaactatatttagtgtatatgcatttacatcatttatatttgtaaagtgatttatcatttac 12265331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University