View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14593_low_20 (Length: 256)
Name: NF14593_low_20
Description: NF14593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14593_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 6236843 - 6236615
Alignment:
| Q |
19 |
agaacacaagtttatatgtttnnnnnnnntatctaaattcatcaaacattttaatttttgattagattttcacctatctaaatatctaaagtctcagttg |
118 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
6236843 |
agaacacaagtttatatgtttaaaaaaaatatctaaattcatcaaacattttaatttttgattagattttcacctatctaaatatctaaagtctcacttg |
6236744 |
T |
|
| Q |
119 |
tgtttgctctcacatacaccgggaagggaatgcagctgctgacgctatggtgaaaaatacgaagagtttacctaccttctcttctcaatggaggatctca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6236743 |
tgtttgctctcacatacaccgggaagggaatgcagctgctgacgctatggcgaaaaatacgaagagtttacctaccttctcttctcaatggaggatctca |
6236644 |
T |
|
| Q |
219 |
ccacccagctttattgcttcttctctctc |
247 |
Q |
| |
|
|||||| ||||||||||||||| |||||| |
|
|
| T |
6236643 |
ccaccctgctttattgcttcttttctctc |
6236615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 33891773 - 33891819
Alignment:
| Q |
49 |
atctaaattcatcaaacattttaattt---ttgattagattttcacc |
92 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
33891773 |
atctaaattcatcaaacattttaatttcaatcgattagattttcacc |
33891819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 92
Target Start/End: Complemental strand, 33952475 - 33952429
Alignment:
| Q |
49 |
atctaaattcatcaaacattttaattt---ttgattagattttcacc |
92 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
33952475 |
atctaaattcatcaaacattttaatttcaatcgattagattttcacc |
33952429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University