View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14593_low_26 (Length: 218)
Name: NF14593_low_26
Description: NF14593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14593_low_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 10 - 166
Target Start/End: Original strand, 43619008 - 43619161
Alignment:
| Q |
10 |
agcacagaaaccagcaacgtaagcacaggccccc-tatgaaacagaaatggaaattctctctttctctccctccctcccaaaaaattgtaaacatacaag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43619008 |
agcacagaaaccagcaacgtaagcacaggcccccctatgaaacagaaatggaaattctctctttctctcc----ctcccaaaaaattgtaaacatacaag |
43619103 |
T |
|
| Q |
109 |
atgaaaaatttgatcataaaatttaatgtttacattaatttagtaggaaaatatatga |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43619104 |
atgaaaaatttgatcataaaatttaatgtttacattaatttagtaggaaaatatatga |
43619161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University