View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14593_low_5 (Length: 378)
Name: NF14593_low_5
Description: NF14593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14593_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 9e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 32475068 - 32475271
Alignment:
| Q |
1 |
agaagaggtacaacttggatagatgac---atatacaaatttgatattttattattaattaaaatgatccgatatgttatactcnnnnnnntccaaatga |
97 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32475068 |
agaagaggtacaacttggatggatgacgacatatacaaatttgatattttattattaattaaaatgatccgatatgttatactcaaaaaagtccaaatga |
32475167 |
T |
 |
| Q |
98 |
atgagtcaaaactatatgaagtactgtaaaggacaaatatttcgctgctagatttttatttagattttgattccatgcaatctagttccaatacaatgaa |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32475168 |
atgagtcaaaactatatgaagtaccgtaaaggacaaatatttcgctgctagatttttatttagattttgattccatgcaatctagttccaatacaatgaa |
32475267 |
T |
 |
| Q |
198 |
ggac |
201 |
Q |
| |
|
|||| |
|
|
| T |
32475268 |
ggac |
32475271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University