View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14594_high_10 (Length: 300)
Name: NF14594_high_10
Description: NF14594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14594_high_10 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 179 - 300
Target Start/End: Complemental strand, 35443393 - 35443272
Alignment:
| Q |
179 |
ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35443393 |
ctctaatatttgcgatacgtcaagtggatccgcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatg |
35443294 |
T |
|
| Q |
279 |
atacacttcactcattgttgat |
300 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35443293 |
atacacttcactcattgttgat |
35443272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University