View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14596_high_4 (Length: 253)
Name: NF14596_high_4
Description: NF14596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14596_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 1245273 - 1245048
Alignment:
| Q |
18 |
cttctaatgctagtttaagcttcatttctgcatcttttaatgcatgtttggtgacttcagcttccaccttcaattcgattgcattgatcttcatatcttc |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1245273 |
cttctaatgctagtttgagcttcatttctgcatcttttaatgcatgtttggtgacttcagcttccaccttcaattcgattgcattgatcttcatatcttc |
1245174 |
T |
|
| Q |
118 |
tgcttctcgctctgcattttcagtttcatcggacaactggttcaatgtcaagatcatttgctcagatgcacccctaactttagattcttctgctaagtag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1245173 |
tgcttctcgctctgcattttcagtttcatcggacaactggttcaatgtcaagatcatttgctcagatgcacccctaactttagattcttctgccaagtag |
1245074 |
T |
|
| Q |
218 |
acatcaagctctgactcacatctctg |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1245073 |
acatcaagctctgactcacatctctg |
1245048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 204
Target Start/End: Complemental strand, 23787775 - 23787735
Alignment:
| Q |
164 |
gtcaagatcatttgctcagatgcacccctaactttagattc |
204 |
Q |
| |
|
||||||||||||| |||||||||||| ||||| |||||||| |
|
|
| T |
23787775 |
gtcaagatcatttcctcagatgcacctctaaccttagattc |
23787735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 243
Target Start/End: Complemental strand, 42009935 - 42009710
Alignment:
| Q |
18 |
cttctaatgctagtttaagcttcatttctgcatcttttaatgcatgtttggtgacttcagcttccaccttcaattcgattgcattgatcttcatatcttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42009935 |
cttctaatgctagtttaagcttcatttctgcatcttttaatgcatgttttgtgacttcagcttccaccttcaattcgattgcattgatcttcatatcttc |
42009836 |
T |
|
| Q |
118 |
tgcttctcgctctgcattttcagtttcatcggacaactggttcaatgtcaagatcatttgctcagatgcacccctaactttagattcttctgctaagtag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
42009835 |
tgcttctcgctctgcattttcagtttcatcggacaactggttcaatgtcaagatcatttgctcagatgcacccctaactttagattcttctgccaagtgg |
42009736 |
T |
|
| Q |
218 |
acatcaagctctgactcacatctctg |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
42009735 |
acatcaagctctgactcacatctctg |
42009710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University