View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14596_low_5 (Length: 234)
Name: NF14596_low_5
Description: NF14596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14596_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 10 - 200
Target Start/End: Original strand, 40655050 - 40655240
Alignment:
| Q |
10 |
aatataataagagggcagggcatggaagtagtttgccgtactttttcggcatttgacatgtttggaattacgttgagtttgaggaaattatgattaactg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |||| |
|
|
| T |
40655050 |
aatataataagagggcagggcatggaagtagtttgccgtactttttcggcatttgacatgtttgaaattacgttgagtttgaggaaattacaatgaacta |
40655149 |
T |
 |
| Q |
110 |
attttgtttaagtttaaaagtgtagtttttgtcaaaaatacaataatacatcataaatttgtcaaatttatcataagttcaaacatgcaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40655150 |
attttgtttaagtttaaaagtgtagtttttgtcaaaaatacaataatacatcataaatttgtcaaatttatcataagttcaaacatgcaag |
40655240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University