View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14598_high_1 (Length: 268)
Name: NF14598_high_1
Description: NF14598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14598_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 39077619 - 39077724
Alignment:
| Q |
1 |
tgccacttgagtcaatgtatatgcttcaaaatttgttcttgttttgtgattattgatgcacttgcttgttgataatgacaaccactgagagtttgattct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39077619 |
tgccacttgagtcaatgtatatgcttcaaaatttgttcttgttttgtgattattgatgcacttgcttgttgataatgacaaccactgagagtttgattct |
39077718 |
T |
 |
| Q |
101 |
ttcttc |
106 |
Q |
| |
|
|||||| |
|
|
| T |
39077719 |
ttcttc |
39077724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 157 - 250
Target Start/End: Original strand, 39077774 - 39077868
Alignment:
| Q |
157 |
ctcttctaattgatgttggatttcttatagaatttcttcatgtggatac-tttttctgaagctgaaaataacccttaattctaccacttatattg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39077774 |
ctcttctaattgatgttggatttcttatagaatttcttcatgtggatacttttttctgaagctgaaaataacccttaattctaccacttatattg |
39077868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University