View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14598_low_12 (Length: 201)
Name: NF14598_low_12
Description: NF14598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14598_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 14 - 131
Target Start/End: Original strand, 29600411 - 29600528
Alignment:
| Q |
14 |
cagagaagagaaaatggagagaaagtttatgatagtgtgctgtattgttggcttcttgggactcttgtctgctgctactagctttgctgcagaagcaaca |
113 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29600411 |
cagagaagagaaaatggagagaaaggttatgatagtgtgctgtattgttggcttcttgggactcttgtctgctgctactagctttgctgcagaagcaaca |
29600510 |
T |
 |
| Q |
114 |
aggattaaggtttctgtc |
131 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
29600511 |
aggattaaggtttctgtc |
29600528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 183
Target Start/End: Original strand, 29600548 - 29600580
Alignment:
| Q |
151 |
ccttaccttggtttcctcgaaaacccatcaagt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
29600548 |
ccttaccttggtttcctcgaaaacccatcaagt |
29600580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University