View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14598_low_8 (Length: 244)
Name: NF14598_low_8
Description: NF14598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14598_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 15 - 95
Target Start/End: Original strand, 39077644 - 39077724
Alignment:
| Q |
15 |
tcaaaatttgttcttgttttgtgattattgatgcacttgcttgttgataatgacaaccactgagagtttgattctttcttc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39077644 |
tcaaaatttgttcttgttttgtgattattgatgcacttgcttgttgataatgacaaccactgagagtttgattctttcttc |
39077724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 146 - 226
Target Start/End: Original strand, 39077774 - 39077855
Alignment:
| Q |
146 |
ctcttctaattgatgttggatttcttatagaatttcttcatgtggatac-tttttctgaagctgaaaataacccttaattct |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39077774 |
ctcttctaattgatgttggatttcttatagaatttcttcatgtggatacttttttctgaagctgaaaataacccttaattct |
39077855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University