View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14599_high_3 (Length: 278)
Name: NF14599_high_3
Description: NF14599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14599_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 2 - 270
Target Start/End: Original strand, 29122028 - 29122296
Alignment:
| Q |
2 |
gttatctgttattgaatctgtgcgcttcaaccctgatgcagaagccatgaattaaattgaagatattgtatatatttattgtttctacaaggagatatgt |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29122028 |
gttatctgttattgaatctgtgcgcttcaaccctgatgcagaagccatgaattaaattgaagatattgtatatatttgttgtttctacaaggagatatgt |
29122127 |
T |
 |
| Q |
102 |
ctcaatttatatccatggctatttatactttgtacattatgtatgaattgggacccatgcaaaggtgcaagagtgggagaaagaacatttgcaatggcca |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29122128 |
ctcaatttatatgcatggctatttatactttgtacattatgtatgaattgggacccatgcaaaggtgcaagagtgggagaaagaacatttgcaatggcca |
29122227 |
T |
 |
| Q |
202 |
atgagtatgagaatttctaagagggaactattggtatcattcttttcttctttgtttcattgtgatgat |
270 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29122228 |
atgagtatgaaaatttctaagagggaactattggtatcattcttttcttctttgtttcattgtggtgat |
29122296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University