View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14599_low_5 (Length: 246)
Name: NF14599_low_5
Description: NF14599
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14599_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 237
Target Start/End: Complemental strand, 42155404 - 42155180
Alignment:
| Q |
13 |
ctattttgattcaaatttcaagcactggttaccataaatcggtcccataaaaacactctatagtattttcaaattttggatccttgttcgtttatgtaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42155404 |
ctattttgattcaaatttcaagcactggttaccataaatcggtcccataaaaacactctatagtattttcaaattttggatccttgttcgtttatgtaaa |
42155305 |
T |
 |
| Q |
113 |
cataaacatcgtgtttgtgactttgtgttggtacaattacaaattagagacaccggcgcaatataaaacaaaaattaataaatgatataaaaccacctct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42155304 |
cataaacatcgtgtttgtgactttgtgttggtacaattacaaattagagacaccggcgcaatataaaacaaaaattaataaatgatataaaaccacctct |
42155205 |
T |
 |
| Q |
213 |
ttgcgctctccgttttgttcccttc |
237 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42155204 |
ttgcgctctccgttttgttcccttc |
42155180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University