View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_100 (Length: 278)
Name: NF1459_high_100
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_100 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 268
Target Start/End: Complemental strand, 1758922 - 1758673
Alignment:
| Q |
19 |
catattgtctggagatatagtggtattcgtcgtacttgttctccttcacttagtaaccgagctcaaaatatttattgcaaagtatcatgttaatgctcca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1758922 |
catattgtctggagatatagtggtattcgtcgtacttgttctccttcacttagtaactgagctcaaaatatttattgcaaagtatcatgttaatgctccg |
1758823 |
T |
|
| Q |
119 |
tcaaatttatctgcatctcatttataattaatccttgttagatgttacgaaggtttaggtgttgatagctagattgatttaccacaattactggtttttc |
218 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1758822 |
tcaaatttatctgtatctcatttataattaatccttgttagatgttacgaaggtttaggtgttgatagctagattgatttaccacaattactggtttttc |
1758723 |
T |
|
| Q |
219 |
atcaagtaattgttccataacannnnnnnnctctaataaaaaggcctatg |
268 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1758722 |
atcaagtaattgttccataacattttttttctctaataaaaaggcctatg |
1758673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University