View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_107 (Length: 261)
Name: NF1459_high_107
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_107 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 246
Target Start/End: Complemental strand, 47198065 - 47197835
Alignment:
| Q |
16 |
atcaatggaggacgattgtgggacttaacgagatccttgaagggactcttaacctcattagccactttactagctctgagtatgtcttcaaactcgggct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47198065 |
atcaatggaggacgattgtgggacttaacgagatccttgaagggactcttaacctcattagccactttactagctctgagtatgtcttcaaactcgggct |
47197966 |
T |
|
| Q |
116 |
caatattttcaacaccacgaatctttcttagaacggctttccctttctcctcgaaacccctttcaatgagactgttgggagtatcatccactataagaga |
215 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47197965 |
caatattttcaacaccacgaatctttgtaagaacggctttccctttctcctcgaaacccctttcaatgagactgttgggagtatcatccactatgagaga |
47197866 |
T |
|
| Q |
216 |
ccccactgtaagcataactgctggaatgatt |
246 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |
|
|
| T |
47197865 |
ccccattgtaagcataactgctggaatgatt |
47197835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 246
Target Start/End: Complemental strand, 47185183 - 47184953
Alignment:
| Q |
16 |
atcaatggaggacgattgtgggacttaacgagatccttgaagggactcttaacctcattagccactttactagctctgagtatgtcttcaaactcgggct |
115 |
Q |
| |
|
||||| ||||| |||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47185183 |
atcaaaggagggagattgtgggacttaacaagatccttgaaggggctcttgacctcattagccactttactagctctgagtatgtcttcaaactcgggct |
47185084 |
T |
|
| Q |
116 |
caatattttcaacaccacgaatctttcttagaacggctttccctttctcctcgaaacccctttcaatgagactgttgggagtatcatccactataagaga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47185083 |
caatattttcaacaccacgaatctttcttagaacggctttccctttctcctcgaaacccctttcaatgagactgttgggagtatcatccactatgagaga |
47184984 |
T |
|
| Q |
216 |
ccccactgtaagcataactgctggaatgatt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47184983 |
ccccactgtaagcataactgctggaatgatt |
47184953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University