View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_114 (Length: 253)
Name: NF1459_high_114
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_114 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 104004 - 104238
Alignment:
| Q |
1 |
atattagagaggttagagagggtgggagggatagaggcagtgagattgttgtggtaaagacccaagctaattaggttcttcaggtttccaagctcttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104004 |
atattagagaggttagagagggtgggagggatagaggcagtgagattgttgtggtaaagacccaagctaattaggttcttcaggtttccaagctcttttg |
104103 |
T |
 |
| Q |
101 |
gtattggacccaccaattcattcttgtacaattctctgcaatcaacaatattaatcaatttatgtcaaagttcagtaaatataagataagagcttaacta |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
104104 |
gtattggacccaccaattcattctcgtacaattctctgcaatcaacaatattaatcaatttatgtcaaagttcagtaaatataagataagagcttaacta |
104203 |
T |
 |
| Q |
201 |
atttgcttacagaaactgaagatggtgaaggttcc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
104204 |
atttgcttacagaaactgaagatggtgaaggttcc |
104238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University