View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_130 (Length: 246)
Name: NF1459_high_130
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_130 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 15 - 229
Target Start/End: Complemental strand, 7429470 - 7429255
Alignment:
| Q |
15 |
caggttctgagagtctgacaagggtcgtgggagagtcagaatcgatcaaagacaaatgataattcaactttagg-acttgtattccatatttttagttcc |
113 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7429470 |
caggttctgagagtttgacaagggtcgtgggagagtcagaatcgatcaaagacaaatgataattcaactttagggacttgtattccatatttttagttcc |
7429371 |
T |
 |
| Q |
114 |
acaaattgaaacatctactttttagttgcatggttaaaaaggagaatgacatgtagacgaggcaacagaggatgccatagtataagagaagcaaagtcaa |
213 |
Q |
| |
|
|| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| || ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7429370 |
acgaattgaaacatctactttctagttgcatggttaaaaaggagaatgacatgtagaccagataacggaggatgccacagtataagagaagcaaagtcaa |
7429271 |
T |
 |
| Q |
214 |
aggtgaagcaccacat |
229 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
7429270 |
agatgaagcaccacat |
7429255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University