View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_147 (Length: 232)
Name: NF1459_high_147
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_147 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 96 - 232
Target Start/End: Complemental strand, 51013460 - 51013324
Alignment:
| Q |
96 |
ataaattggagtttcatcaaggtaataaggtctaaccaatatttgtttcaatcaataattgaacttaggttttcttgaatagtacagtcattggtaaaac |
195 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
51013460 |
ataaattggagtttcaccaaggtaataaggtctaaccaatatttgtttcaatcaataattgaactcgggttctcttaaatagtacagtcattggtaaaac |
51013361 |
T |
|
| Q |
196 |
tcgaacagattctcttgaacggttcggtctttggtaa |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51013360 |
tcgaacagattctcttgaacggttcggtctttggtaa |
51013324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University