View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_150 (Length: 230)
Name: NF1459_high_150
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_150 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 29947027 - 29946803
Alignment:
| Q |
1 |
tggacactgacacgtgccagacaccgggcacggtttcaatctaaagt------gtcggtacttcaaagatcagaagtgtttgtgctacatatgtgattat |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29947027 |
tggacactgacacgtgccagacaccgggcacggtttcaatctaaagttagattgtcg-tactaaaaagatcagaagtgtttgtgctacatatgtgattat |
29946929 |
T |
 |
| Q |
95 |
tgatgttgttgtttgatttctacnnnnnnnagggtcttgacttttgacttgttttgtaggctaaacttgttaagcttcccaagaatcttttggcgaaggt |
194 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29946928 |
tgatgttgttgtttgatttctactttttt-agggtcttgacttttgacttgttttgtaggctaaacttgttaagcttcccaagaatcttttggcgaaggt |
29946830 |
T |
 |
| Q |
195 |
ttctactgttaagaacacagagcaggt |
221 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
29946829 |
ttctactgttaagaacacacagcaggt |
29946803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University