View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_157 (Length: 223)
Name: NF1459_high_157
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_157 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 7 - 185
Target Start/End: Complemental strand, 52621039 - 52620860
Alignment:
| Q |
7 |
cttaattaccagtattcccctgtctcatgataaatatcttacttttattttgaagaaaatatctt-acttggaattgtgcataatttttaagaaaataat |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52621039 |
cttaattaccagtattcccctgtctcatgataaatatcttacttttattttgaaggaaatatctttacttggaattgtgcataatttttaagaaaataat |
52620940 |
T |
|
| Q |
106 |
taggttaggttgatttttccttaaaaaatgttacttagtttgattttaattatcaaataaatttcatttgctaaaatatc |
185 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52620939 |
taggtgaggttgatttttccttaaaaaatgttacttaggttgattttaattatcaaataaatttcatttgctaaaatatc |
52620860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University