View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_158 (Length: 222)
Name: NF1459_high_158
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_158 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 21 - 206
Target Start/End: Complemental strand, 40870949 - 40870764
Alignment:
| Q |
21 |
atagtatttagtcaattttcaatattaattcaaaatataaggtaatcctcacatataaatttgtattgactcctgcagtataacctggttgaagcttaac |
120 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40870949 |
atagtatttagtcaattttcaacattaattcaaaatataaggtaatcctcacatataaatttgtattgactcctgcagtataacctggttgaagcttaac |
40870850 |
T |
|
| Q |
121 |
cgcagtaccaaaatatccagatttataagagtgatatgacttgaatccactccctgtgttgcaaagaaatgcttagaagtggtaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40870849 |
cgcagtaccaaaatatccagatttataagagtgatatgacttgaatccactccctgtgttgcaaagaaatgcttagaagtggtaag |
40870764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 89 - 185
Target Start/End: Original strand, 21085410 - 21085506
Alignment:
| Q |
89 |
actcctgcagtataacctggttgaagcttaaccgcagtaccaaaatatccagatttataagagtgatatgacttgaatccactccctgtgttgcaaa |
185 |
Q |
| |
|
||||| |||||||| || || |||||||||| |||| |||||| ||||| ||||||||||| ||| ||||||||||||||| ||| |||| |||| |
|
|
| T |
21085410 |
actccagcagtatagccaggatgaagcttaattgcagcaccaaagtatccggatttataagaatgaagtgacttgaatccactacctatgtttcaaa |
21085506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University