View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1459_high_162 (Length: 218)

Name: NF1459_high_162
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1459_high_162
NF1459_high_162
[»] chr4 (1 HSPs)
chr4 (104-198)||(22579622-22579716)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 104 - 198
Target Start/End: Complemental strand, 22579716 - 22579622
Alignment:
104 aaacacaaccgccatagaaagtggaaacccatcaatttaattgaaaaatgttagtaaattaattgttatagcattagtttttctgtttcctctaa 198  Q
    |||| ||| |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |||||    
22579716 aaactcaatcgccatggaaagtggaaacccatcaatttaattggaaaatgttagtaaattaattgttatagcattagtttttctctttcgtctaa 22579622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University