View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1459_high_168 (Length: 211)
Name: NF1459_high_168
Description: NF1459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1459_high_168 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 28226334 - 28226158
Alignment:
| Q |
18 |
cttttcgatttcttatgattctttagaatatgatgcatatgaaaatgaatggaaaaagggcatgtgaaattcacctcaagatagatatcaatggctttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226334 |
cttttcgatttcttatgattctttagaatatgatgcatatgaaaatgaatggaaaaagggcatgtgaaattcacctcaagatagatatcaatggctttgt |
28226235 |
T |
|
| Q |
118 |
agaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactccaagaaatttagagatctttaggttc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28226234 |
agaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactccaagaaatttagagatctttaggttc |
28226158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 86 - 186
Target Start/End: Original strand, 13040378 - 13040478
Alignment:
| Q |
86 |
attcacctcaagatagatatcaatggctttgtagaccccatcaaagcaatcccttgcagaatcaggcaaacattctgcaactccaagaaatttagagatc |
185 |
Q |
| |
|
|||||||||||| ||||| ||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||| ||||| | || |||||||||||| |
|
|
| T |
13040378 |
attcacctcaaggtagatgtcaatggctctatagaccccatcaaagcaatcccttgcaaaatcaggcaaacattctacaacttctaggaatttagagatc |
13040477 |
T |
|
| Q |
186 |
t |
186 |
Q |
| |
|
| |
|
|
| T |
13040478 |
t |
13040478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University